Last rendered: July 2026 — see Major Versions for full environment details.

WGS fastq2vcf walkthrough

Initial publication year: 2022
How to cite

Stacks

If your samples need to be demultiplexed, running the program Stacks is a necessary first step. Stack’s process_radtags function searches sequence reads for barcodes that you provide and demultiplexes the reads using your barcode file. This file specifies which barcode belongs to which sample and will trim off those barcodes once it demultiplexes.

Example scenario

Samples used as examples throughout this walkthrough were multiplexed using 3 different unique sequences. Every sample had a unique combination of an i5 primer, i7 primer and adapter barcode. Data from the sequencing facility will demultiplex to the level of unique combinations of i5 and i7 primers. Therefore for these samples, there were 32 unique i5 and i7 primer combinations and so the sequencing facility sent 64 fastq.gz files: one for the forward sequence and one for the reverse for all 32 combinations. We will take one file as an example in the following code.

Stacks Walkthrough

process_radtags walkthrough

Barcode File: For each set of paired end files that need to be demultiplexed, a barcode file needs to be created. For example, for files i5-4-i7-11_R1_001.fastq.gz and i5-4-i7-11_R2_001.fastq.gz its barcode file is as follows:

ATCACG  ATCACG  Pop6_18001
CGATGT  CGATGT  Pop7_18173
TTAGGC  TTAGGC  Pop8_18148
TGGCCA  TGGCCA  Pop9_18064
ACAGTG  ACAGTG  Pop3_16228
GCCAAT  GCCAAT  Pop4_17210
CAGATC  CAGATC  Pop6_18035
ACTTGA  ACTTGA  Pop6_18038
GATCAG  GATCAG  Pop8_18130
TAGCTT  TAGCTT  Pop8_18113
GGCTAC  GGCTAC  Pop7_18190
CTTGCA  CTTGCA  Pop1_17327

This file contains the 12 barcodes that have the i5_4 and i7_11 index and which sample that combination belongs to. This file is tab delimited and because I had inline barcodes, meaning they were the same on both ends of the read, I have the same barcode sequence in the first and second column. Then the sample ID is on the right.

Sample naming convention is important for downstream steps. The way the example samples are named are first a “Pop” identifier for what a priori population they belonged to (see Sample Notes file for example population IDs). Then a 5-digit identifier for the specific sample from that population where the first two digits represent the year the sample was collected and the last 3 digits represent the individual sample ID from that sampling year.

We provide a simple R script to create the barcode files for each primer index combination. See file: Stacks_FileCreate_OmicsWG.R. You can use the practice files provide to see how the code works or just input your own to make the files you need. This file may be modified to fit your needs and there are annotations where that would be the case.

Additional Flags

-p path to your genome files. If you have paired data (forward and reverse reads), put your two fastq files in the same folder and only have those two files in it. I created folders for each index combination to keep everything organized and easy to run stacks on.

-o path to where you want your output files to go. For subsequent steps, you’ll want all of these demultiplexed files in the same folder. Create a folder like “Stacks_Out” where you write all your files to.

-b path to your barcode file

--inline_inline The barcode option flag has 6 different options and you have to use the proper flag for your barcodes or indexes that need to be demultiplexed. Because the example samples have inline barcodes on either end of the sequence if using the practice data you need to use the –inline_inline flag.

-P If paired end sequencing was used, you need to add the -P flag to indicate this.

--disable_rad_check this flag is needed if you are doing anything other than RAD-seq. Stacks defaults to requiring cutsite sequences that are used in RAD-seq, but for WGS you won’t have cut sites and need to disable the rad check.

-r this flag allows Stacks to rescue any barcodes that are off by one bp. For example, the barcode ACTTGA might appear as CTTGA or TACTTGA. This should only be a small percentage of reads and will probably recover about 1% of reads.

Code for running Stacks

process_radtags -P -p {Path to genome files} -o {Path for output} -b {barcode file} --inline_inline --disable_rad_check -r

Example code for running on a Cluster

You can run the practice data files using the format below while changing the path on your computer to fit your needs.

#!/bin/bash
#SBATCH --job-name=stacks_i54_i711                # sets the job name
#SBATCH --mem=1Gb                                 # reserves 1 GB memory
#SBATCH --mail-user=schaal.s@northeastern.edu     # set your email to get notifications about your run
#SBATCH --mail-type=FAIL                          # if the job fails for any reason email the provided email
#SBATCH --time=24:00:00                           # reserves machines/cores for 24 hours.
#SBATCH --output=stacksi54_i711.%j.out            # sets the standard output to be stored in file, where %j is the job id
#SBATCH --error=stacksi54_i711.%j.err             # sets the standard error to be stored in file

process_radtags -P -p ./genomeFilesi54_i711/ -o ./Stacks_Out/ -b barcodeFilei54_i711.txt --inline_inline --disable_rad_check -r

This will create four new fastq files for each sample provided in the barcodeFile. Because the practice data is a subset of the full dataset, this will only fill files with reads that are included in the subset file. The process_radtags program wants to keep the reads in phase, so that the first read in the sample_XXX.1.fq file is the mate of the first read in the sample_XXX.2.fq file. Likewise for the second pair of reads being the second record in each of the two files and so on. When one read in a pair is discarded due to low quality or a missing restriction enzyme cut site, the remaining read can’t simply be output to the sample_XXX.1.fq or sample_XXX.2.fq files as it would cause the remaining reads to fall out of phase. Instead, this read is considered a remainder read and is output into the sample_XXX.rem.1.fq file if the paired-end was discarded, or the sample_XXX.rem.2.fq file if the single-end was discarded.

There will also be a log file that summarizes the number of reads per sample that were retained, were low quality, or that had noRADtag (only relevant for rad data).

Results for a run with one primer combination on the full paired end data files that for each ~30GB in size

Time: each file took approx. 7 hrs
Memory: approx. 80 MB RAM Run description: run on separate cluster nodes for 32 different primer combinations

Read 1 Post Stacks for example sample Pop3_17304

[schaal.s@login-00 Stacks_Out]$ zcat Pop3_17304.1.fq.gz | head -n 10

@218_1_1101_1090_1000/1
CTGTGCGTTGGCCTGCGGGCTGACTCGGTCCTGAGATGGACTGCTGTGTAGTTTGAACCATAGATTCATTATATAGAACACGGTCTCCTCTGCGCTGCTGGCCAATGGAGCCGAACGTCCGCACTGGCGGGCGGCCATCTTGCC
+
,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF,:FFFFFFFFF:FFFFFFF:FFFFFFFFFFFFF:FFFFFFF
@218_1_1101_1687_1000/1 TCCCTCTCACTCTCCTCTCCGTCTCCTCTTTTGTCCTCGTCTCTCTCCTCTCTCCCTCTCTCCCATCTCCCTCTCTATCAAGTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGC
+
,FFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFF:FFFF:::F,F::FFFFF
@218_1_1101_6840_1000/1
AAAAAATACATAGCGGCCATGGACAGGATGACCTCTATGACAATGATAGAAACAGAAAGGACGCGGAGACTCTTGAGTCATCAAGTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTC

Read 2 Post Stacks for example sample Pop3_17304

[schaal.s@login-00 Stacks_Out]$ zcat Pop3_17304.2.fq.gz | head -n 10

@218_1_1101_1090_1000/2
AGGCAAGATGGCCGCCCGCCAGTGCGGACGTTCGGCTCCATTGGCCAGCAGCGCAGAGGAGACCGTGTTCTATATAATGAATCTATGGTTCAAACTACACAGCAGTCCATCTCAGGACCGAGTCAGCCCGCAGGCCAACGCACA
+
,FFFF:FFFFFF:FFFFFFFFFFFFFFFFFF:FFFFFFF:,FFFFF:FF,FFFFFFFFFFFFFFF,F,:FFFF:F,FFFFF:FF,FFFF,FFFFFF,FFF,FF:FFFFF:F:FFFF,FFF:F:F:FFFFFFFFFFF,:FFFFFF
@218_1_1101_1687_1000/2
AAGAGAGGGAGATGGGAGAGAGGGAGAGAGGAGAGAGACGAGGACAAAAGAGGAGACGGAGAGGAGAGTGAGAGGGATCAAGTAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCTCGGTGGTCGC
+
,FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF,FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF,FF:
@218_1_1101_6840_1000/2
AGACTCAAGAGTCTCCGCGTCCTTTCTGTTTCTATCATTGTCATAGAGGTCATCCTGTCCATGGCCGCTATGTATTTTTATCAAGTAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCTCGGTGGT



Quality Trimming

Before sequence alignment to a reference genome, you need to trim your sequence data of bases that you have low confidence in being correct. This is to ensure that you have high confidence in both your alignment and the downstream variant calls. There are a few programs that do this including Trimmomatic and Fast P, but this walkthrough will describe Fast P and settings used for this program.

Alignment

There are multiple programs used for aligning short reads to a reference: Bowtie, Bowtie2, BWA, STAR, etc. Here I will describe the steps I took using BWA.

First step: index your genome

Download your genome from the NCBI database or UCSC database and run bwa index to index the genome. This allows BWA to essentially make a catalog (i.e., index) of the locations in the genome to make alignment faster.

Code for running BWA index

bwa index {Path to .fna genome file}

Example code for running on a cluster

#!/bin/bash
#SBATCH --job-name=subGenomesBWA                              
#SBATCH --mem=2Gb
#SBATCH --mail-user=schaal.s@northeastern.edu
#SBATCH --mail-type=FAIL
#SBATCH --partition=lotterhos
#SBATCH --time=6:00:00
#SBATCH --nodes=1
#SBATCH --tasks-per-node=1                        
#SBATCH --output=indexGenomeBWA.%j.out                
#SBATCH --error=indexGenomeBWA.%j.err         

bwa index Cod_genome/GCF_902167405.1_gadMor3.0_genomic.fna

Results

Time: 9 minutes Memory: 1 GB of RAM

Second step: alignment with BWA-MEM

There are a number of parameters to change in the bwa alignment. It is worth playing with parameters and outputting summary information to evaluate how well the alignment worked.

Dr. Jon Puritz provides an open sourced guide for testing parameters to ensure you get the best alignment results (DOUBLE CHECK WITH HIM THAT IT IS OKAY FOR US TO PUT THIS IN HERE). General advice is that a gap penalty of 5 and a mismatch penalty of 3 consistently gives better results with a lot of marine species. However, it’s worth doing a couple of test runs with 3–5 samples comparing that to the default.

Arguments

-B mismatch penalty used to adjust alignment scores based on the number of mismatches in the aligned sequence

-O gap penalty used to adjust alignment scores based on the number and length of gaps and mismatches are when there are bases that deviate from the reference that the read is aligning to. This helps alleviate sequencing errors influencing the alignment.

-a output all found alignments for SE or unpaired paired end; flagged as secondary alignments

-M mark shorter split hits as secondary

-R RGline (reference) because you will eventually be merging files this flag is important to add in the sample ID associated with these reads in the actual alignment file. This will remain in the file then for downstream analyses.

Code for running BWA index

bwa mem -O {num} -B {num} -a -M -R {Path to .fna genome file} {Path to sample .fg.gz forward read} {Path to sample .fg.gz reverse read}  > {Path to outfile location for .sam file}

Example for running on a Cluster

#!/bin/bash
#SBATCH --job-name=Pop3_17304_submitBWA
#SBATCH --mem=3Gb
#SBATCH --mail-user=schaal.s@northeastern.edu
#SBATCH --mail-type=FAIL
#SBATCH --partition=lotterhos
#SBATCH --time=15:00:00
#SBATCH --nodes=1
#SBATCH --tasks-per-node=1
#SBATCH --output=BWA_Out/clustOut/Pop3_17304.%j.out
#SBATCH --error=BWA_Out/clustOut/Pop3_17304.%j.err

bwa mem -O 5 -B 3 -a -M -R BWA_genome/GCF_902167405.1_gadMor3.0_genomic.fna FastP_Out/Pop3_17304.R1.fq.gz FastP_Out/Pop3_17304.R2.fq.gz  > BWA_Out/Pop3_17304aln.sam

Results (per sample):

Time: 7-10 hours Memory: about 1.5 GB

Third Step: check alignment stats using samtools view and flagstat

Code for running samtools

samtools view -Sbt {Path to .fna genome file} {Path to .sam aligned sample file} | samtools flagstat -

Example for running on a Cluster

#!/bin/bash
#SBATCH --job-name=Pop7_18156_alnCheckDef
#SBATCH --mem=2Gb
#SBATCH --mail-user=schaal.s@northeastern.edu
#SBATCH --mail-type=FAIL
#SBATCH --partition=lotterhos
#SBATCH --time=4:00:00
#SBATCH --nodes=1
#SBATCH --tasks-per-node=1
#SBATCH --output=clustOut/Pop7_18156_def.%j.out
#SBATCH --error=clustOut/Pop7_18156_def.%j.err

samtools view -Sbt ../BWA_genome/GCF_902167405.1_gadMor3.0_genomic.fna ../BWA_Out/Pop7_18156alnDef.sam | samtools flagstat -

example output from flagstat (sample: Pop1_16216):

75779849 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
1183259 + 0 supplementary
0 + 0 duplicates
74456805 + 0 mapped (98.25% : N/A)
74596590 + 0 paired in sequencing
37298295 + 0 read1
37298295 + 0 read2
70915282 + 0 properly paired (95.07% : N/A)
73157116 + 0 with itself and mate mapped
116430 + 0 singletons (0.16% : N/A)
2026064 + 0 with mate mapped to a different chr
739870 + 0 with mate mapped to a different chr (mapQ>=5)

Here you want to maximize your properly paired reads and percent mapped to the genome. Try a few parameters and see how you can maximize this.

Line 1 - total: the total number of alignments that pass the quality filter, this isn’t the total number of reads. To get the total number of reads, subtract the secondary, supplementary, and duplicate values from this number which will be R1 + R2.
Line 2 - secondary: (0x100 bit set) Line 3 - supplementary: Supplementary alignments are those alignments that are part of a chimeric alignment (0x800 bit set) Line 4 - duplicates: these mark potential PCR duplicates. This value should be zero if you filtered out all the pcr duplicates using picard tools (0x400 bit set) Line 5 - mapped: (0x4 bit not set) Line 6 - paired in sequencing: (0x1 bit set) Line 7 - read1: (both 0x1 and 0x40 bits set) Line 8 - read2: (both 0x1 and 0x80 bits set) Line 9 - properly paired: (both 0x1 and 0x2 bits set and 0x4 bit not set) Line 10 - with itself and mate mapped: (0x1 bit set and neither 0x4 nor 0x8 bits set) Line 11 - singletons: Singleton is a mapped read whose mate is unmapped (both 0x1 and 0x8 bits set and bit 0x4 not set) Line 12 - with mate mapped to different chr: low quality reads mapping to different chromosomes Line 13 - with mate mapped to different chr (mapQ>=5): higher quality reads mapping to different chromosome



Sort and index your alignment

Once you have aligned your reads to the reference you need to sort and index them for downstream use. This can be done using samtools.

Step 1: convert your sam files to bam

Bam files are much smaller than sam files. By converting your files to Bam, you willincrease downstream efficiency.

Code for running samtools for Sam to Bam conversion

samtools view -S -b {Path to .sam file} > {Path for output .bam file}

Example for running on a Cluster

#!/bin/bash
#SBATCH --job-name=Pop4_17226_alnSamToBam
#SBATCH --mem=2Gb
#SBATCH --mail-user=schaal.s@northeastern.edu
#SBATCH --mail-type=FAIL
#SBATCH --partition=lotterhos
#SBATCH --time=4:00:00
#SBATCH --nodes=1
#SBATCH --tasks-per-node=1
#SBATCH --output=samtools_samToBam_Out/clustOut/Pop4_17226.%j.out
#SBATCH --error=samtools_samToBam_Out/clustOut/Pop4_17226.%j.err

samtools view -S -b BWA_Out/Pop4_17226aln.sam > samtools_samToBam_Out/Pop4_17226aln.bam

Results (per sample):

Time: 35-40 minutes Memory: about 20MB


Step 2: Sort your bam files

Sorting files takes a lot of memory, but not a lot of time. There is one trick about the memory part to keep in mind. You need to set memory for the cluster, but you also need to set the memory allotment allowed for samtools sort to store data in. If you make the memory in samtools too low it will create 100s to 1000s of temporary files that it will later need to knit back together. For the example shown here, the memory was increased so that samtools didn’t have to create temporary files. HOWEVER, you need to set the memory to a value that is lower than what you give to the cluster. If it is exactly the same or near the amount you gave to the cluster, it will fail and say you will get an error saying the program went over the memory limits. Therefore, for this example 40GB of memory was set in the samtools code and 50 GB of memory was set for each sample on the cluster.

Code for running samtools for sorting bam file

samtools sort -m {memory allocation to samtools} {Path to .bam file} > {Path for output sorted .bam file}

Example for running on a Cluster

#!/bin/bash
#SBATCH --job-name=Pop4_17226_alnSortedBam
#SBATCH --mem=50Gb
#SBATCH --mail-user=schaal.s@northeastern.edu
#SBATCH --mail-type=FAIL
#SBATCH --partition=lotterhos
#SBATCH --time=24:00:00
#SBATCH --nodes=1
#SBATCH --tasks-per-node=1
#SBATCH --output=samtools_sortedBam_Out/clustOut/Pop4_17226.%j.out
#SBATCH --error=samtools_sortedBam_Out/clustOut/Pop4_17226.%j.err

samtools sort -m 40G samtools_samToBam_Out/Pop4_17226aln.bam > samtools_sortedBam_Out/Pop4_17226aln.sorted.bam

Results (per sample):

Time: about 10 min
Memory: 40GB


Step 3: Index your sorted bam file

Code for running samtools for indexing sorted bam file

samtools index {Path to sorted .bam file} > {Path for output sorted and indexed .bam file}

Example for running on a Cluster

#!/bin/bash
#SBATCH --job-name=Pop4_17226_alnIndexBam
#SBATCH --mem=50Mb
#SBATCH --mail-user=schaal.s@northeastern.edu
#SBATCH --mail-type=FAIL
#SBATCH --partition=lotterhos
#SBATCH --time=2:00:00
#SBATCH --nodes=1
#SBATCH --tasks-per-node=1
#SBATCH --output=samtools_indexedBam_Out/clustOut/Pop4_17226.%j.out
#SBATCH --error=samtools_indexedBam_Out/clustOut/Pop4_17226.%j.err

samtools index samtools_sortedBam_Out/Pop4_17226aln.sorted.bam > samtools_indexedBam_Out/Pop4_17226aln_sorted_indexed

Results (per sample):

Time: about 3-5 min
Memory: about 15 MB



Checking alignment

First step: identifying regions to calculate coverage

It is important to check your coverage along each chromosome to determine whether you have regions of low or no coverage that could bias downstream analyses. One way to evaluate this is to first download the GFF file from NCBI for the genome of your species. As an example here is a link to the Atlantic cod genome used for the analysis examples in this walkthrough: Atlantic cod genome

Then subset the genome file for the chromosomes or genomic regions you want to evaluate coverage. Below is an example of subsetting the Atlantic cod genome for all 23 chromosomes in the R programming language:

cod.gff <- read.table("src/alignment/GCF_902167405.1_gadMor3.0_genomic.gff", sep = "\t", quote = "")
scaffolds.gff <- cod.gff[cod.gff$V3 == "region",]
chrom.gff <- scaffolds.gff[1:23,]
write.table(chrom.gff, "src/alignment/GCF_902167405.1_gadMor3.0_genomic_chroms.gff", row.names = FALSE, 
            sep = "\t", col.names = FALSE, quote = FALSE)

Second step: calculating coverage

Code for running bedtools coverage

bedtools coverage -a {Path to GFF file created in previous step} -b {Path to aligned, sorted and indexed .bam file} -sorted -d > {Path for output .txt file}

Example for running on a Cluster

#!/bin/bash
#SBATCH --job-name=Pop1_16216_bedCov
#SBATCH --mem=50Gb
#SBATCH --mail-user=schaal.s@northeastern.edu
#SBATCH --mail-type=FAIL
#SBATCH --partition=lotterhos
#SBATCH --time=4:00:00
#SBATCH --nodes=1
#SBATCH --tasks-per-node=1
#SBATCH --output=bedtools_coverage/clustOut/Pop1_16216bedCov.%j.out
#SBATCH --error=bedtools_coverage/clustOut/Pop1_16216bedCov.%j.err
bedtools coverage -a Cod_genome_data/GCF_902167405.1_gadMor3.0_genomic_chroms.gff -b samtools_sortedBam_Out/Pop1_16216aln.sorted.bam -sorted -d > bedtools_coverage/Pop1_16216.coverageCalcDflag.txt 

-a reference genome

-b sorted bam file

-d give per base coverage

-sorted tells bedtools that this file is already sorted

Third step: subsetting

Subset for just the chromosome data and the columns of interest in the output file (reduces file sizes from 111GB to 17GB this part can easily be piped so you aren’t creating that large intermediate file)

#!/bin/bash
#SBATCH --job-name=Pop1_16216_alnCheck
#SBATCH --mem=2Gb
#SBATCH --mail-user=schaal.s@northeastern.edu
#SBATCH --mail-type=FAIL
#SBATCH --partition=lotterhos
#SBATCH --time=4:00:00
#SBATCH --nodes=1
#SBATCH --tasks-per-node=1
#SBATCH --output=bedtools_coverage/clustOut/Pop1_16216awk.%j.out
#SBATCH --error=bedtools_coverage/clustOut/Pop1_16216awk.%j.err
awk -F"\t" '$1~/NC*/' bedtools_coverage/Pop1_16216.coverageCalcDflag.txt | awk '{print $1,$11,$12}' > bedtools_coverage/Pop1_16216.coverageCalcChr.txt

Fourth step: calculate coverage average

run the output file through the R script for calculating averages for different window sizes and plot results in ggplot


### PROCESS COVERAGE DATA TO VISUALIZE ACROSS THE GENOME ###
## Sara M. Schaal

## LOAD LIBRARIES
library(ggplot2)
library(data.table)

## USER INPUTS
setwd("/scratch/schaal.s/CodGenomes") # SET YOUR WORKING DIRECTORY
samps <- c("Pop1_16216", "Pop1_17291", "Pop4_17236", "Pop5_17278", "Pop6_18017") # INPUT SAMPLES OF INTEREST
colors <- c("steelblue2", "chartreuse3", "orchid2", "firebrick1", "goldenrod2") # INPUT COLORS 
n <- 10000 # INPUT SIZE OF WINDOWS TO CALCULATE AVERAGE COVERAGE

## PROCESS DATA 
# first step through each sample
for(i in 1:length(samps)){
  df <- fread(paste0("bedtools_coverage/", samps[i], ".coverageCalcChr.txt"), 
                                                      sep =" ", quote = "", data.table = FALSE)
  colnames(df) <- c("chrom", "base", "coverage")
  chroms <- unique(df[,1])
  df.sample.data <- NULL
  # step through each chromosome and break into the increment chunks you set with n
  for(j in 1:length(chroms)){
    df.chrom <- df[df$chrom == chroms[j], ]
    extra <- nrow(df.chrom) %% n
    # this next part is taking our windows set by n and giving each window a number id
    # this grouped dataframe is made by binding the original df.chrom with grouping values for the window size you want 
    # then finding what the last grouping value would be using because it will most like not be an even increment of your n
    # for example if you divide a chromosome by your n and get 3000.3 then you can easily input the first 3000
    # grouping values in with rep (middle part of the following cbind function) then the last grouping value will be 3001 which
    # you get by rounding using ceiling in the last part of this cbind
    grouped <- cbind(df.chrom, c(rep(1:(nrow(df.chrom)/n), each = n), rep(ceiling(nrow(df.chrom)/n), extra)))
    colnames(grouped)[4] <- "grouping"
    # now bind this chromosomes data in the full dataframe
    df.sample.data <- rbind(df.sample.data, grouped)
  }
  # finally take your new dataframe and calculate the average coverage for your increments using
  # this new grouping variable and the chromosome
  df.covAve <- aggregate(coverage~grouping + chrom, data = df.sample.data, FUN = mean)
 

  #### PLOTTING ####
  pdf(paste0("figures/", samps[i], "MaxcoveragePlot", n, ".pdf"), height= 15, width=15)

  ## I make two plots because there will undoubtedly be some loci that have really high coverage which makes
  # it hard to see all the spread of the majority of the data. This first graph is set to the max coverage
  # found in the data frame and the second plot is setting your y limit to a more reasonable value for your
  # data. For me 100 x was good but feel free to change to what is appropriate for your data.

  print(ggplot(data = df.covAve, aes(x = grouping, y = coverage)) +
    geom_point(col = colors[i], alpha = 0.5) +
    facet_wrap(~chrom) +
    labs(y = "Coverage", x = paste0("location every ", n, " bases"), 
         title = paste0(samps[i], "Genome Coverage up to Max Coverage")) +
    ylim(0, max(df.covAve$coverage)) +
    xlim(0, max(df.covAve$grouping)) +
    theme_bw() + 
    theme(panel.border = element_blank(), panel.grid.major = element_blank(), 
          panel.grid.minor = element_blank(),
          axis.line = element_line(colour = "black"), 
          legend.position = "none"))
  dev.off()
  
  pdf(paste0("figures/", samps[i], "100XcoveragePlot", n, ".pdf"), height= 15, width=15)
  
  print(ggplot(data = df.covAve, aes(x = grouping, y = coverage)) +
          geom_point(col = colors[i], alpha = 0.5) +
          facet_wrap(~chrom) +
          labs(y = "Coverage", x = paste0("location every ", n, " bases"),
               title = paste0(samps[i], "Genome Coverage up to 100X")) +
          ylim(0, 100) +
          xlim(0, max(df.covAve$grouping)) +
          theme_bw() + 
          theme(panel.border = element_blank(), panel.grid.major = element_blank(), 
                panel.grid.minor = element_blank(),
                axis.line = element_line(colour = "black"), 
                legend.position = "none"))
  dev.off()
  
}

Results (R script for 5 samples):

Time: about 4.5 hours
Memory: about 85 GB



Picard MarkDuplicates

The tool’s main output is a new SAM or BAM file, in which duplicates have been identified in the SAM flags field for each read. Duplicates are marked with the hexadecimal value of 0x400, which corresponds to a decimal value of 1024. For the example data shown in this walkthrough, OPTICAL_DUPLICATE_PIXEL_DISTANCE=2500 needs to be set which is for data coming from a patterned flow cell. The example whole genome data comes from a NovaSeq run which uses the patterned flow cell. The default for that flag is only 100 which is appropriate for unpatterned flow cells. Make sure you know which technology your data come from and set this parameter as needed.

Samtools filtering

Before running the SNP caller, you need to filter the samples to ensure you are only using good quality aligned data. To do this, the bam file is filtered using samtools view.

Code from dDocent for quality filtering:

samtools view -@32 -h -q 10 -F 0x100 -F 0x400 $1-RGmd.bam | mawk '$6 !~/[8-9].[SH]/ && $6 !~ /[1-9][0-9].[SH]/' | samtools view -@ 32 -b

In dDocent, all reads are filtered if mapping quality is less than 10, removes PCR duplicates (marked in previous Picard step this quality filter then removes them) with the -F 0x400 flag and removes non primary alignments with the 0x100. The mawk line of code then removes hard and soft clipped reads. Finally, the last samtools view code exports the results as a bam file.

-@ option allocates threads for the job

-h include the header in the output

-q skip alignments with MAPQ smaller than INT[0]

-F Do not output alignments with any bits set in INT present in the FLAG field. INT can be specified in hex by beginning with 0x’ (i.e. /^0x[0-9A-F]+/) or in octal by beginning with 0’ (i.e. /^0[0-7]+/) [0]

-b output in the bam format

Example for an altered dDocent code

Changed the mawk code to not remove the hard clipped reads because I am interested in inversion breakpoints. This would most likely filter those out.

Example for running on a cluster

#!/bin/bash
#SBATCH --job-name=samtoolsFilter
#SBATCH --mem=750Mb
#SBATCH --mail-user=schaal.s@northeastern.edu
#SBATCH --mail-type=FAIL
#SBATCH --partition=lotterhos
#SBATCH --time=0:30:00
#SBATCH --cpus-per-task=2
#SBATCH --output=../samtools_filter_Out/clustOut/samtoolsFilter.%j.out
#SBATCH --error=../samtools_filter_Out/clustOut/samtoolsFilter.%j.err

samtools view -@2 -h -q 10 -F 0x100 -F 0x400 ../picard_Out/Pop1_16216aln.sorted.md.bam | mawk '$6 !~ /[1-9][0-9].[SH]/'| samtools view -@2 -b > ../samtools_filter_Out/Pop1_16216.f.bam

Results (per sample):

Time: 15-20 min
Memory: about 500MB



Merge Reads

Before calling SNPs you need to merge all your per sample Bam files. This is why we had to add the RG ids during the mapping step. This ensures all reads have a unique identifier for which sample they belong to once merged. By merging all the reads, the SNP caller doesn’t need to keep opening and closing individual sample files, which will increase the runtime. You need to make a text file that includes all the bamfile names that you want to merge and then run the line of code below. Because this is computationally intensive, I used 32 cpus on a single compute node.

SNP calling

There are two major variant callers that are widely used: GATK and Freebayes. Here we walk through using freebayes-parallel to optimize runtime on our cluster. SNP calling is computationally intensive so this step will take some work to optimize both the size of genome chunks you want to analyze at a time and how many cpus to run your samples on.

There are a few files that you need for this step: 1) your population list file which has a line per sample where the sample name is the first item in the line and the population ID is the second item in the line (see example header of a population list file below) 2) your .fna genome reference that you are calling snps from and 3) regions file where you tell freebayes what size chunks of the genome you want to analyze at a time. Depending on your coverage, this last file is very important to troubleshoot to maximize memory use vs. run times. In the example data, we found we were reaching about 90% efficiency on our cluster with 9-13 hour runs using 64 cores and allotting 90 GB of memory when we split the genome up into 100kb chunks. So this is how we proceeded and ran each chromosome individually by splitting them each up into 100kb chunks.